Antisense Oligo (ASO) Reverse Complement Tool
Generate the reverse complement (5′→3′) of a Antisense Oligo (ASO) sequence — for antisense oligonucleotide design. Runs in your browser; the sequence is never uploaded.
TAGCTAGCTAGCCATGCTAGC🔒 100% client-side — your data is computed in the browser and never uploaded.
Cite this tool
ToolJolt. Antisense Oligo (ASO) Reverse Complement Tool. ToolJolt Chemistry & Lab Tools; 2026. https://tooljolt.comAntisense Oligo (ASO) Reverse Complement Tool for molecular biologists, geneticists and bioinformaticians. Enter your values and read a sourced, step-by-step result instantly, right in your browser.
About Antisense Oligo (ASO) Reverse Complement Tool
Generate the reverse complement (5′→3′) of a Antisense Oligo (ASO) sequence — for antisense oligonucleotide design. Runs in your browser; the sequence is never uploaded. Why it matters: Primer design, GC content and melting temperature decide whether a PCR amplifies cleanly or produces nothing. Small sequence mistakes propagate into failed experiments and wasted reagents. Reverse-complementing is the basis of antisense oligonucleotide design. Before you trust the number, double-check: mismatched forward/reverse primer Tm; primers with runs of G/C causing mispriming; ignoring secondary structure in GC-rich templates. Everything is computed on your own device — nothing you enter is uploaded — so the tool is safe for unpublished sequences, proprietary formulations and sensitive measurements, and easy to cite in a methods section or lab SOP.
How to use Antisense Oligo (ASO) Reverse Complement Tool
- 1Enter your input values.
- 2Read the headline result and the supporting figures, which recompute as you type.
- 3Open “Worked example with your numbers” to see the substituted formula step by step.
- 4Copy the result, or use the cite-this-tool snippet for your methods section.
Why use Antisense Oligo (ASO) Reverse Complement Tool?
- ✓Instant, client-side result — works offline once loaded and keeps your data private
- ✓Shows the worked example step by step with your own numbers, not just a final figure
- ✓Pre-filled with sensible, niche-specific defaults so it is useful the second it loads
- ✓Mobile-friendly and completely free, with no sign-up or usage caps
- ✓Built on a sourced, unit-tested formula for nucleic-acid sequence analysis
Frequently asked questions
Any tips specific to this calculation?+
Reverse-complementing is the basis of antisense oligonucleotide design. Also watch out for: mismatched forward/reverse primer Tm and reading the wrong strand or frame.
Is this antisense oligo (aso) reverse complement tool free to use?+
Yes. It is completely free, needs no sign-up, and runs entirely in your browser — there are no usage limits.
What formula does it use?+
The exact formula and a step-by-step worked example are shown beneath the result.
What are the most common mistakes here?+
In nucleic-acid sequence analysis, watch for: mismatched forward/reverse primer Tm; primers with runs of G/C causing mispriming; ignoring secondary structure in GC-rich templates; reading the wrong strand or frame. This tool shows the working so you can catch these before they cost an experiment.
Does my data leave my device?+
No. All computation happens locally in your browser. Nothing you enter — sequences, concentrations or measurements — is uploaded to any server, so it is safe for confidential work.
Can I cite this tool?+
Yes — use the “Cite this tool” snippet on the page. Many users link these calculators from methods sections, lab SOPs and teaching materials.
Related tools
Related Chemistry tools
Sodium Chloride (NaCl) Molarity Calculator
Calculate the molarity (mol/L) of a Sodium Chloride (NaCl) solution from the mass you weighed out and your final volume — shows the working and the millimolar value.
● LivePotassium Chloride (KCl) Molarity Calculator
Calculate the molarity (mol/L) of a Potassium Chloride (KCl) solution from the mass you weighed out and your final volume — shows the working and the millimolar value.
● LiveD-Glucose Molarity Calculator
Calculate the molarity (mol/L) of a D-Glucose solution from the mass you weighed out and your final volume — shows the working and the millimolar value.
● Live