siRNA Reverse Complement Tool
Generate the reverse complement (5′→3′) of a siRNA sequence — for deriving the antisense siRNA strand. Runs in your browser; the sequence is never uploaded.
GAGCTCGGTACCAAGCTTGGATCCGGCTAACGTACGCAT🔒 100% client-side — your data is computed in the browser and never uploaded.
Cite this tool
ToolJolt. siRNA Reverse Complement Tool. ToolJolt Chemistry & Lab Tools; 2026. https://tooljolt.comsiRNA Reverse Complement Tool for molecular biologists, geneticists and bioinformaticians. Enter your values and read a sourced, step-by-step result instantly, right in your browser.
About siRNA Reverse Complement Tool
Generate the reverse complement (5′→3′) of a siRNA sequence — for deriving the antisense siRNA strand. Runs in your browser; the sequence is never uploaded. Why it matters: Primer design, GC content and melting temperature decide whether a PCR amplifies cleanly or produces nothing. Small sequence mistakes propagate into failed experiments and wasted reagents. Reverse-complementing is the basis of deriving the antisense siRNA strand. Before you trust the number, double-check: mismatched forward/reverse primer Tm; primers with runs of G/C causing mispriming; ignoring secondary structure in GC-rich templates. Everything is computed on your own device — nothing you enter is uploaded — so the tool is safe for unpublished sequences, proprietary formulations and sensitive measurements, and easy to cite in a methods section or lab SOP.
How to use siRNA Reverse Complement Tool
- 1Enter your input values.
- 2Read the headline result and the supporting figures, which recompute as you type.
- 3Open “Worked example with your numbers” to see the substituted formula step by step.
- 4Copy the result, or use the cite-this-tool snippet for your methods section.
Why use siRNA Reverse Complement Tool?
- ✓Built on a sourced, unit-tested formula for nucleic-acid sequence analysis
- ✓Links to related nucleic-acid sequence analysis calculators so you can finish the whole workflow
- ✓Copy-ready result and a one-line “cite this tool” snippet for your methods section
- ✓Designed for molecular biologists, geneticists and bioinformaticians who need a trustworthy answer fast
- ✓Instant, client-side result — works offline once loaded and keeps your data private
Frequently asked questions
Any tips specific to this calculation?+
Reverse-complementing is the basis of deriving the antisense siRNA strand. Also watch out for: mismatched forward/reverse primer Tm and reading the wrong strand or frame.
Is this sirna reverse complement tool free to use?+
Yes. It is completely free, needs no sign-up, and runs entirely in your browser — there are no usage limits.
What formula does it use?+
The exact formula and a step-by-step worked example are shown beneath the result.
What are the most common mistakes here?+
In nucleic-acid sequence analysis, watch for: mismatched forward/reverse primer Tm; primers with runs of G/C causing mispriming; ignoring secondary structure in GC-rich templates; reading the wrong strand or frame. This tool shows the working so you can catch these before they cost an experiment.
Does my data leave my device?+
No. All computation happens locally in your browser. Nothing you enter — sequences, concentrations or measurements — is uploaded to any server, so it is safe for confidential work.
Can I cite this tool?+
Yes — use the “Cite this tool” snippet on the page. Many users link these calculators from methods sections, lab SOPs and teaching materials.
Related tools
- Fusion Protein Translation (Codon → Protein) Tool
- Bacterial Genome GC Content Calculator
- qPCR Amplicon GC Content Calculator
- PCR Primer Melting Temperature (Tm) Calculator
- TaqMan Probe Melting Temperature (Tm) Calculator
- Multiplex PCR Primer Melting Temperature (Tm) Calculator
- HEPES Buffer Capacity Calculator
Related Chemistry tools
Sodium Chloride (NaCl) Molarity Calculator
Calculate the molarity (mol/L) of a Sodium Chloride (NaCl) solution from the mass you weighed out and your final volume — shows the working and the millimolar value.
● LivePotassium Chloride (KCl) Molarity Calculator
Calculate the molarity (mol/L) of a Potassium Chloride (KCl) solution from the mass you weighed out and your final volume — shows the working and the millimolar value.
● LiveD-Glucose Molarity Calculator
Calculate the molarity (mol/L) of a D-Glucose solution from the mass you weighed out and your final volume — shows the working and the millimolar value.
● Live